Review



wrl68 cells atcc cl  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    ATCC wrl68 cells atcc cl
    Wrl68 Cells Atcc Cl, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pm41348543-177-120-122
    Average 94 stars, based on 40 article reviews
    wrl68 cells atcc cl - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Activity Assay:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..

    Enzyme-linked Immunosorbent Assay:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..

    Gene Expression:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..

    RNA Sequencing:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..

    Planar Chromatography:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..

    Transgenic Assay:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..

    Recombinant:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..

    Software:

    Article Title: Post-translational switch of DHCR24 acetylation sustains sterol synthesis and promotes HCC via the 7-ketocholesterol/p62 axis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DHCR24 mouse monoclonal antibody Proteintech Cat# 60028-1-I; RRID: AB_874115 DHCR24-K254ac polyclonal antibody This paper N/A SQLE polyclonal antibody Proteintech Cat# 12544-1-AP; RRID: AB_2195888 KAT2A/GCN5 monoclonal antibody Proteintech Cat# 28390-1-AP; RRID:AB_3669658 KAT6B rabbit polyclonal antibody ABclonal Cat# A17116; RRID:AB_2770037 PCNA mouse monoclonal antibody Proteintech Cat# 60097-1-Ig; RRID: AB_2236728 p62/SQSTM1 polyclonal antibody Proteintech Cat# 18420-1-AP; RRID: AB_10694431 LC3B rabbit monoclonal antibody PTM Biolabs Cat# PTM-6384; RRID: AB_3644237 β-Actin monoclonal antibody Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Bacterial and virus strains AAV8-TBG-P2A-GFP This paper N/A AAV8-Dhcr24-WT (WT) This paper N/A AAV8-Dhcr24-K254R (K254R) This paper N/A AAV8-Dhcr24-K254Q (K254Q) This paper N/A Biological samples Human HCC and adjacent normal samples 4th Affiliated Hospital of Harbin Medical University N/A Chemicals, peptides, and recombinant proteins Chloroquine GLPBIO Cat# GC19549 Rapamycin GLPBIO Cat# GC15031 Cycloheximide GLPBIO Cat# GC17198 MG132 GLPBIO Cat# GC41233 7-keto cholesterol GLPBIO Cat# GC40572 Cholesterol GLPBIO Cat# GC17398 N-Nitrosodiethylamine Aladdin N109571 Carbon tetrachloride Macklin C805329 Irbesartan Aladdin I129263 Puromycin dihydrochloride GLPBIO Cat# GC16384 N-acetylcysteine (NAC) Aladdin Cat# N351774 Hydrogen peroxide solution (H 2 O 2 ) Aladdin Cat# H112519 Total RNA Isolation Reagent Yamei Cat# YY101L Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific Cat# 11668027 Opti-MEM Thermo Fisher Scientific Cat# 31985070 RIPA buffer Yamei Cat# PC104 Critical commercial assays Cholesterol/Cholesteryl Ester Detection Kit abcam Cat# ab65359 7-ketocholesterol (7-KC) ELISA KIT Spbio SP40217 AST Activity Assay Kit Solarbio Cat# BC1565 (Continued on next page) Cell Reports 44, 116640, December 23, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER ALT Activity Assay Kit Solarbio Cat# BC1555 Mouse AFP ELISA Kit Proteintech Cat# KE10122 rProtein A/G Magnetic IP/Co-IP Kit ACE Cat# BK0004-02 PrimeScriptTM RT reagent Kit TaKaRa Cat# RR047A Deposited data Proteomic dataset (Fudan University, OEP000321) The National Omics Data Encyclopedia (NODE) NODE: OEP000321 GEO database Gene Expression Omnibus GEO: http://www.ncbi.nlm.nih.gov/geo/ TCGA-LIHC dataset TCGA Research Network TCGA: TCGA-LIHC RNA-seq (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012783 Metabolomics (Dhcr24 hepKO and Alb-Cre livers) This paper OMIX (NGDC): OMIX012782 Experimental models: Cell lines Human: HepG2 cells ATCC HB-8065; RRID: CVCL_0027 Human: SK-Hep1 cells ATCC HTB-52; RRID: CVCL_0525 Human: PLC/PRF/5 cells ATCC CRL-8024; RRID: CVCL_0485 Human: MHCC97H cells Sun Yat-sen University N/A; RRID: CVCL_4972 Human: WRL68 cells ATCC CL-48; RRID: CVCL_0581 Experimental models: Organisms/strains Dhcr24 floxed mice (loxP sites flanking exon 3) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:000664 Balb/c nude mice Beijing Charles River Laboratory Animal Technology Co., Ltd, Background strain: BALB/c nude; RRID: IMSR_CRL:194 B6.Cg-Tg(Alb-cre)21Mgn/J (Alb-Cre transgenic mice) Biocytogen Pharmaceuticals (Beijing) Co., Ltd, Background strain: C57BL/6J; RRID: IMSR_JAX:003574 Oligonucleotides Dhcr24 flox (up-F): GTCTGGCTAG CCAACTTGCTCTGA This paper N/A Dhcr24 flox (up-R): CTCAGCAGTT AAGAGGGCTGGATAC This paper N/A Dhcr24 flox (down-F): GTTTGGGC CAGAAATAGCCTTGCTC This paper N/A Dhcr24 flox (down-R): GCAGTAG TGGCTGACACCTTTAATC This paper N/A Alb-Cre-F: GCGATCGCTGCCAGGATATACG This paper N/A Alb-Cre-R: CCAGAGTCATCCTTAGCGCCGT This paper N/A KAT2A-F: CAGGGTGTGCTGAACTTTGTG This paper N/A KAT2A-R: TCCAGTAGTTAAGGCAGAGCAA This paper N/A Recombinant DNA lentiCRISPRv2-sgDHCR24 (human) This paper N/A pCDH-DHCR24-WT This paper N/A pCDH-DHCR24-K254R This paper N/A pCDH-DHCR24-K254Q This paper N/A Software and algorithms Graphpad Prism 10 GraphPad Software version 10.1.1 SPSS Software IBM SPSS Statistics version 21.0 Nikon Capture NX 2.1.1 Nikon Corporation https://www.nikon.com/ (Continued on next page) 14 Cell Reports 44, 116640, December 23, 2025 ..



    Similar Products

    94
    ATCC wrl68 cells atcc cl
    Wrl68 Cells Atcc Cl, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pm41348543-177-120-122
    Average 94 stars, based on 1 article reviews
    wrl68 cells atcc cl - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    ATCC wrl68 liver cell lines
    Wrl68 Liver Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pm39316971-62-3-11
    Average 94 stars, based on 1 article reviews
    wrl68 liver cell lines - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    ATCC wrl68 cell lines
    Isolation of exosomes from HepG2.2.15 cells. A: Analysis of the exosome marker protein CD9, expressed in HepG2.2.15, HepG2 and <t>WRL68</t> cells, conducted via western blotting; B: Representative TEM examination images depicting exosomes secreted from HepG2.2.15 cells. Note scale bar: 0.1 nm; C: Determination of size distribution of the isolated exosomes, as measured by nanoparticle tracking analysis.
    Wrl68 Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pmc11135406-71-3-10
    Average 94 stars, based on 1 article reviews
    wrl68 cell lines - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    ATCC normal cell line wrl68
    Isolation of exosomes from HepG2.2.15 cells. A: Analysis of the exosome marker protein CD9, expressed in HepG2.2.15, HepG2 and <t>WRL68</t> cells, conducted via western blotting; B: Representative TEM examination images depicting exosomes secreted from HepG2.2.15 cells. Note scale bar: 0.1 nm; C: Determination of size distribution of the isolated exosomes, as measured by nanoparticle tracking analysis.
    Normal Cell Line Wrl68, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pm38421316-130-6-17
    Average 94 stars, based on 1 article reviews
    normal cell line wrl68 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    ATCC normal liver cell line wrl68
    Isolation of exosomes from HepG2.2.15 cells. A: Analysis of the exosome marker protein CD9, expressed in HepG2.2.15, HepG2 and <t>WRL68</t> cells, conducted via western blotting; B: Representative TEM examination images depicting exosomes secreted from HepG2.2.15 cells. Note scale bar: 0.1 nm; C: Determination of size distribution of the isolated exosomes, as measured by nanoparticle tracking analysis.
    Normal Liver Cell Line Wrl68, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pm38218456-63-2-25
    Average 94 stars, based on 1 article reviews
    normal liver cell line wrl68 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    ATCC normal liver cell lines wrl68
    Figure 1. The lncGCLC expression in MCLR-exposed cells and population samples. (A) Changes of lncGCLC expression in <t>WRL68</t> cells after exposure to 0 or 10 µg/L of MCLR for 0, 10, 15, and 25 passages. * p < 0.05 compared with passage-matched control cells. (B) Comparison of lncGCLC expression in WRL68, HepG2, and SMMC7721 cells. ** p < 0.01 compared with WRL68 cells. (C) Com- parison of lncGCLC expression in tumor tissue and adjacent normal tissue from HCC patients with MC exposure (n = 30), ** p < 0.01. (D) LncGCLC expression in HCC patients with high MC exposure (serum MCs ≥0.14 µg/L, n = 17) was lower than that in those with low MC exposure (serum MCs < 0.14 µg/L, n = 13), ** p < 0.01. Data are presented as the mean ± SD of three independent experiments.
    Normal Liver Cell Lines Wrl68, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pm36851037-42-2-19
    Average 94 stars, based on 1 article reviews
    normal liver cell lines wrl68 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    ATCC wrl68 human hepatic cells
    Figure 1. The lncGCLC expression in MCLR-exposed cells and population samples. (A) Changes of lncGCLC expression in <t>WRL68</t> cells after exposure to 0 or 10 µg/L of MCLR for 0, 10, 15, and 25 passages. * p < 0.05 compared with passage-matched control cells. (B) Comparison of lncGCLC expression in WRL68, HepG2, and SMMC7721 cells. ** p < 0.01 compared with WRL68 cells. (C) Com- parison of lncGCLC expression in tumor tissue and adjacent normal tissue from HCC patients with MC exposure (n = 30), ** p < 0.01. (D) LncGCLC expression in HCC patients with high MC exposure (serum MCs ≥0.14 µg/L, n = 17) was lower than that in those with low MC exposure (serum MCs < 0.14 µg/L, n = 13), ** p < 0.01. Data are presented as the mean ± SD of three independent experiments.
    Wrl68 Human Hepatic Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pm35794289-48-0-13
    Average 94 stars, based on 1 article reviews
    wrl68 human hepatic cells - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    ATCC wrl68 cells
    Fargesone A reverses hepatocyte injury in a partial FXR-dependent manner in the human <t>WRL68</t> cell line. Lentivirus-mediated FXR knockdown (shRNA-FXR) in the human WRL68 cell line and scrambled shRNA was used as control (shRNA-Control). (A, B) mRNA and protein levels of FXR were confirmed by QPCR and western blot to verify the effectiveness of FXR stable silencing in cells. (C, D) shRNA-Control and shRNA-FXR human liver WRL68 cells were incubated with 400 μM oleic acid (OA) and treated with DMSO or 10 μM FA for 24 h. Lipid accumulation in cells was determined by Oil Red O staining (C) and the corresponding quantifications of positive Oil Red O staining area (D). P values were determined by one-way ANOVA with Tukey’s multiple comparison post hoc test, *** P < 0.001. Values are the mean ± SEM of three independent experiments.
    Wrl68 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/wrl68+cells+atcc+cl/Wrl+68/pmc09795464-77-24-26
    Average 94 stars, based on 1 article reviews
    wrl68 cells - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    Image Search Results


    Isolation of exosomes from HepG2.2.15 cells. A: Analysis of the exosome marker protein CD9, expressed in HepG2.2.15, HepG2 and WRL68 cells, conducted via western blotting; B: Representative TEM examination images depicting exosomes secreted from HepG2.2.15 cells. Note scale bar: 0.1 nm; C: Determination of size distribution of the isolated exosomes, as measured by nanoparticle tracking analysis.

    Journal: World Journal of Gastroenterology

    Article Title: HepG2.2.15-derived exosomes facilitate the activation and fibrosis of hepatic stellate cells

    doi: 10.3748/wjg.v30.i19.2553

    Figure Lengend Snippet: Isolation of exosomes from HepG2.2.15 cells. A: Analysis of the exosome marker protein CD9, expressed in HepG2.2.15, HepG2 and WRL68 cells, conducted via western blotting; B: Representative TEM examination images depicting exosomes secreted from HepG2.2.15 cells. Note scale bar: 0.1 nm; C: Determination of size distribution of the isolated exosomes, as measured by nanoparticle tracking analysis.

    Article Snippet: HepG2.2.15, HepG2, and WRL68 cell lines were obtained from the American Type Culture Collection (United States).

    Techniques: Isolation, Marker, Western Blot

    The impact of HepG2.2.15-derived exosomes on the activation of LX2 cells. A: Display of LX2 cells in a normal culture environment, showing red lipid droplets; B: Illustration of LX2 cells co-cultured with HepG2-exo. Similar to the normal culture, red lipid droplets are present; C: Depiction of LX2 cells co-cultured with WRL68-exo. Also maintains presence of red lipid droplets; D: Representation of LX2 cells when co-cultured with HepG2.2.15-exo. Notably, after 24 h of oil red staining, the red lipid droplets disappear, indicating a significant change caused by the HepG2.2.15-exo. Magnification Times: 20 ×.

    Journal: World Journal of Gastroenterology

    Article Title: HepG2.2.15-derived exosomes facilitate the activation and fibrosis of hepatic stellate cells

    doi: 10.3748/wjg.v30.i19.2553

    Figure Lengend Snippet: The impact of HepG2.2.15-derived exosomes on the activation of LX2 cells. A: Display of LX2 cells in a normal culture environment, showing red lipid droplets; B: Illustration of LX2 cells co-cultured with HepG2-exo. Similar to the normal culture, red lipid droplets are present; C: Depiction of LX2 cells co-cultured with WRL68-exo. Also maintains presence of red lipid droplets; D: Representation of LX2 cells when co-cultured with HepG2.2.15-exo. Notably, after 24 h of oil red staining, the red lipid droplets disappear, indicating a significant change caused by the HepG2.2.15-exo. Magnification Times: 20 ×.

    Article Snippet: HepG2.2.15, HepG2, and WRL68 cell lines were obtained from the American Type Culture Collection (United States).

    Techniques: Derivative Assay, Activation Assay, Cell Culture, Staining

    Figure 1. The lncGCLC expression in MCLR-exposed cells and population samples. (A) Changes of lncGCLC expression in WRL68 cells after exposure to 0 or 10 µg/L of MCLR for 0, 10, 15, and 25 passages. * p < 0.05 compared with passage-matched control cells. (B) Comparison of lncGCLC expression in WRL68, HepG2, and SMMC7721 cells. ** p < 0.01 compared with WRL68 cells. (C) Com- parison of lncGCLC expression in tumor tissue and adjacent normal tissue from HCC patients with MC exposure (n = 30), ** p < 0.01. (D) LncGCLC expression in HCC patients with high MC exposure (serum MCs ≥0.14 µg/L, n = 17) was lower than that in those with low MC exposure (serum MCs < 0.14 µg/L, n = 13), ** p < 0.01. Data are presented as the mean ± SD of three independent experiments.

    Journal: Toxics

    Article Title: Downregulation of LncRNA GCLC-1 Promotes Microcystin-LR-Induced Malignant Transformation of Human Liver Cells by Regulating GCLC Expression.

    doi: 10.3390/toxics11020162

    Figure Lengend Snippet: Figure 1. The lncGCLC expression in MCLR-exposed cells and population samples. (A) Changes of lncGCLC expression in WRL68 cells after exposure to 0 or 10 µg/L of MCLR for 0, 10, 15, and 25 passages. * p < 0.05 compared with passage-matched control cells. (B) Comparison of lncGCLC expression in WRL68, HepG2, and SMMC7721 cells. ** p < 0.01 compared with WRL68 cells. (C) Com- parison of lncGCLC expression in tumor tissue and adjacent normal tissue from HCC patients with MC exposure (n = 30), ** p < 0.01. (D) LncGCLC expression in HCC patients with high MC exposure (serum MCs ≥0.14 µg/L, n = 17) was lower than that in those with low MC exposure (serum MCs < 0.14 µg/L, n = 13), ** p < 0.01. Data are presented as the mean ± SD of three independent experiments.

    Article Snippet: The human normal liver cell lines WRL68 and human hepatoma cell lines (HepG2 and SMMC7721) were purchased from the American Type Culture Collection (Manassas, VA, USA).

    Techniques: Expressing, Control, Comparison

    Figure 2. Knockdown of lncGCLC promoted the proliferation of MCLR-treated WRL68 cells. Vector- or sh-lncGCLC-transfected cells were treated with or without 10 µg/L of MCLR for 25 passages. (A) The expression of lncGCLC was detected using qRT-PCR. (B) Cell proliferation activity was detected by CCK-8. (C) Cell apoptosis was analyzed using flow cytometry. (D) Apoptosis rate in each group. (E) The percentage distribution of cells in the G1/G0, S, and G2/M phases of the cell cycle was determined by flow cytometry. (F) Cell cycle distribution quantification. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Journal: Toxics

    Article Title: Downregulation of LncRNA GCLC-1 Promotes Microcystin-LR-Induced Malignant Transformation of Human Liver Cells by Regulating GCLC Expression.

    doi: 10.3390/toxics11020162

    Figure Lengend Snippet: Figure 2. Knockdown of lncGCLC promoted the proliferation of MCLR-treated WRL68 cells. Vector- or sh-lncGCLC-transfected cells were treated with or without 10 µg/L of MCLR for 25 passages. (A) The expression of lncGCLC was detected using qRT-PCR. (B) Cell proliferation activity was detected by CCK-8. (C) Cell apoptosis was analyzed using flow cytometry. (D) Apoptosis rate in each group. (E) The percentage distribution of cells in the G1/G0, S, and G2/M phases of the cell cycle was determined by flow cytometry. (F) Cell cycle distribution quantification. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Article Snippet: The human normal liver cell lines WRL68 and human hepatoma cell lines (HepG2 and SMMC7721) were purchased from the American Type Culture Collection (Manassas, VA, USA).

    Techniques: Knockdown, Plasmid Preparation, Transfection, Expressing, Quantitative RT-PCR, Activity Assay, CCK-8 Assay, Cytometry, Control

    Figure 3. Knockdown of lncGCLC promoted the migration and invasion of MCLR-treated WRL68 cells. Vector- or sh-lncGCLC-transfected cells were treated with or without 10 µg/L of MCLR for 25 passages. (A) Representative images of a cell migration assay (100×), scale bar = 200 µm. (B) Quantification of cell migration. (C) Representative images of a cell invasion assay (Original magnification ×100, scale bar = 200 µm). (D) Quantification of cell invasion. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Journal: Toxics

    Article Title: Downregulation of LncRNA GCLC-1 Promotes Microcystin-LR-Induced Malignant Transformation of Human Liver Cells by Regulating GCLC Expression.

    doi: 10.3390/toxics11020162

    Figure Lengend Snippet: Figure 3. Knockdown of lncGCLC promoted the migration and invasion of MCLR-treated WRL68 cells. Vector- or sh-lncGCLC-transfected cells were treated with or without 10 µg/L of MCLR for 25 passages. (A) Representative images of a cell migration assay (100×), scale bar = 200 µm. (B) Quantification of cell migration. (C) Representative images of a cell invasion assay (Original magnification ×100, scale bar = 200 µm). (D) Quantification of cell invasion. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Article Snippet: The human normal liver cell lines WRL68 and human hepatoma cell lines (HepG2 and SMMC7721) were purchased from the American Type Culture Collection (Manassas, VA, USA).

    Techniques: Knockdown, Migration, Plasmid Preparation, Transfection, Cell Migration Assay, Invasion Assay, Control

    Figure 4. Knockdown of lncGCLC promoted the growth of MCLR-induced malignantly transformed WRL68 cells in nude mice. Vector- or sh-lncGCLC-transfected cells were treated with or without 10 µg/L of MCLR for 25 passages. (A) Representative images of a soft agar assay (Original magnifica- tion ×200, scale bar = 100 µm). (B) Quantification of colony formation in soft agar. (C) Tumorigenicity test of BALB/c nude mice was performed. Solid tumors were removed after the sacrifice at 22 days. (D) Representative image showing subcutaneous tumor size. (E) The weights of solid tumors. The values given are mean ± SD (n = 3 for both male and female nude mice per group). (F) Tumor volume was monitored every 3 days after injection of WRL68 cells. (G) Pathological changes of the tumor tissue in nude mice in each group (HE stains, original magnification ×400, scale bar = 50 µm). ND—not detected. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Journal: Toxics

    Article Title: Downregulation of LncRNA GCLC-1 Promotes Microcystin-LR-Induced Malignant Transformation of Human Liver Cells by Regulating GCLC Expression.

    doi: 10.3390/toxics11020162

    Figure Lengend Snippet: Figure 4. Knockdown of lncGCLC promoted the growth of MCLR-induced malignantly transformed WRL68 cells in nude mice. Vector- or sh-lncGCLC-transfected cells were treated with or without 10 µg/L of MCLR for 25 passages. (A) Representative images of a soft agar assay (Original magnifica- tion ×200, scale bar = 100 µm). (B) Quantification of colony formation in soft agar. (C) Tumorigenicity test of BALB/c nude mice was performed. Solid tumors were removed after the sacrifice at 22 days. (D) Representative image showing subcutaneous tumor size. (E) The weights of solid tumors. The values given are mean ± SD (n = 3 for both male and female nude mice per group). (F) Tumor volume was monitored every 3 days after injection of WRL68 cells. (G) Pathological changes of the tumor tissue in nude mice in each group (HE stains, original magnification ×400, scale bar = 50 µm). ND—not detected. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Article Snippet: The human normal liver cell lines WRL68 and human hepatoma cell lines (HepG2 and SMMC7721) were purchased from the American Type Culture Collection (Manassas, VA, USA).

    Techniques: Knockdown, Transformation Assay, Plasmid Preparation, Transfection, Soft Agar Assay, Injection, Control

    Figure 5. Verification of the interrelationships among lncGCLC, miR-122-5p, and GCLC. (A) The mRNA expression level of neighboring genes which are located nearly 1.5 Mb downstream of lncGCLC in lncGCLC knockdown cells. * p < 0.05 and ** p < 0.01 compared with vector control cells. (B) The expression level of lncGCLC in the nuclear and cytoplasmic fractions of WRL68 cells. (C) The correlation between the lncGCLC expression and the GCLC expression in HCC tissues (n = 30). Correlation coefficient (r) and P value were calculated by Pearson correlation analysis. (D) Comparison of GCLC expression in tumor tissue and adjacent normal tissue from HCC patients with MC exposure (n = 30), ** p < 0.01. (E) GCLC expression in HCC patients with high MC exposure (serum MCs ≥0.14 µg/L, n =17) was lower than in those with low MC exposure (serum MCs < 0.14 µg/L, n = 13), ** p < 0.01. (F) After exposure to 10 µg/L of MCLR for 0, 10, 15, and 25 passages, expression of lncGCLC, miR-122-5p and GCLC mRNA was detected in WRL68 cells. * p < 0.05 and ** p < 0.01 compared with passage-matched control cells. (G,H) Expression of GCLC protein in P0, P10, P15 and P25 MCLR-induced malignantly transformed WRL68 cells. ** p < 0.01 compared with passage-matched control cells. (I) Changes of miR-122-5p in both vector- and sh-lncGCLC-transfected WRL68 cells treated with 0 or 10 µg/L of MCLR for 25 passages. (J–L) Changes of GCLC mRNA (J) and protein (K,L) expression in both vector- and sh-lncGCLC-transfected WRL68 cells treated with or without 10 µg/L of MCLR for 25 passages. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Journal: Toxics

    Article Title: Downregulation of LncRNA GCLC-1 Promotes Microcystin-LR-Induced Malignant Transformation of Human Liver Cells by Regulating GCLC Expression.

    doi: 10.3390/toxics11020162

    Figure Lengend Snippet: Figure 5. Verification of the interrelationships among lncGCLC, miR-122-5p, and GCLC. (A) The mRNA expression level of neighboring genes which are located nearly 1.5 Mb downstream of lncGCLC in lncGCLC knockdown cells. * p < 0.05 and ** p < 0.01 compared with vector control cells. (B) The expression level of lncGCLC in the nuclear and cytoplasmic fractions of WRL68 cells. (C) The correlation between the lncGCLC expression and the GCLC expression in HCC tissues (n = 30). Correlation coefficient (r) and P value were calculated by Pearson correlation analysis. (D) Comparison of GCLC expression in tumor tissue and adjacent normal tissue from HCC patients with MC exposure (n = 30), ** p < 0.01. (E) GCLC expression in HCC patients with high MC exposure (serum MCs ≥0.14 µg/L, n =17) was lower than in those with low MC exposure (serum MCs < 0.14 µg/L, n = 13), ** p < 0.01. (F) After exposure to 10 µg/L of MCLR for 0, 10, 15, and 25 passages, expression of lncGCLC, miR-122-5p and GCLC mRNA was detected in WRL68 cells. * p < 0.05 and ** p < 0.01 compared with passage-matched control cells. (G,H) Expression of GCLC protein in P0, P10, P15 and P25 MCLR-induced malignantly transformed WRL68 cells. ** p < 0.01 compared with passage-matched control cells. (I) Changes of miR-122-5p in both vector- and sh-lncGCLC-transfected WRL68 cells treated with 0 or 10 µg/L of MCLR for 25 passages. (J–L) Changes of GCLC mRNA (J) and protein (K,L) expression in both vector- and sh-lncGCLC-transfected WRL68 cells treated with or without 10 µg/L of MCLR for 25 passages. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Article Snippet: The human normal liver cell lines WRL68 and human hepatoma cell lines (HepG2 and SMMC7721) were purchased from the American Type Culture Collection (Manassas, VA, USA).

    Techniques: Expressing, Knockdown, Plasmid Preparation, Control, Comparison, Transformation Assay, Transfection

    Figure 6. Knockdown of lncGCLC reduced GSH levels and induced oxidative DNA damage in MCLR-treated WRL68 cells. Alterations in GCL activity (A), GSH (B), and 8-OHdG content (C) in vector- or sh-lncGCLC-transfected cells exposed to 0 or 10 µg/L of MCLR for 25 passages. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Journal: Toxics

    Article Title: Downregulation of LncRNA GCLC-1 Promotes Microcystin-LR-Induced Malignant Transformation of Human Liver Cells by Regulating GCLC Expression.

    doi: 10.3390/toxics11020162

    Figure Lengend Snippet: Figure 6. Knockdown of lncGCLC reduced GSH levels and induced oxidative DNA damage in MCLR-treated WRL68 cells. Alterations in GCL activity (A), GSH (B), and 8-OHdG content (C) in vector- or sh-lncGCLC-transfected cells exposed to 0 or 10 µg/L of MCLR for 25 passages. Data are presented as the means ± SD of three independent experiments in each group. * p < 0.05 compared with the control group; # p < 0.05 compared with the sh-NC group; † p < 0.05 compared with the sh-NC + MCLR group.

    Article Snippet: The human normal liver cell lines WRL68 and human hepatoma cell lines (HepG2 and SMMC7721) were purchased from the American Type Culture Collection (Manassas, VA, USA).

    Techniques: Knockdown, Activity Assay, Plasmid Preparation, Transfection, Control

    Fargesone A reverses hepatocyte injury in a partial FXR-dependent manner in the human WRL68 cell line. Lentivirus-mediated FXR knockdown (shRNA-FXR) in the human WRL68 cell line and scrambled shRNA was used as control (shRNA-Control). (A, B) mRNA and protein levels of FXR were confirmed by QPCR and western blot to verify the effectiveness of FXR stable silencing in cells. (C, D) shRNA-Control and shRNA-FXR human liver WRL68 cells were incubated with 400 μM oleic acid (OA) and treated with DMSO or 10 μM FA for 24 h. Lipid accumulation in cells was determined by Oil Red O staining (C) and the corresponding quantifications of positive Oil Red O staining area (D). P values were determined by one-way ANOVA with Tukey’s multiple comparison post hoc test, *** P < 0.001. Values are the mean ± SEM of three independent experiments.

    Journal: JACS Au

    Article Title: Biomimetic Total Synthesis and the Biological Evaluation of Natural Product (−)-Fargesone A as a Novel FXR Agonist

    doi: 10.1021/jacsau.2c00600

    Figure Lengend Snippet: Fargesone A reverses hepatocyte injury in a partial FXR-dependent manner in the human WRL68 cell line. Lentivirus-mediated FXR knockdown (shRNA-FXR) in the human WRL68 cell line and scrambled shRNA was used as control (shRNA-Control). (A, B) mRNA and protein levels of FXR were confirmed by QPCR and western blot to verify the effectiveness of FXR stable silencing in cells. (C, D) shRNA-Control and shRNA-FXR human liver WRL68 cells were incubated with 400 μM oleic acid (OA) and treated with DMSO or 10 μM FA for 24 h. Lipid accumulation in cells was determined by Oil Red O staining (C) and the corresponding quantifications of positive Oil Red O staining area (D). P values were determined by one-way ANOVA with Tukey’s multiple comparison post hoc test, *** P < 0.001. Values are the mean ± SEM of three independent experiments.

    Article Snippet: To determine whether FA could alleviate lipid accumulation and cell death in liver cells through an FXR-dependent manner, we stably silenced FXR expression in WRL68 cells (ATCC) using lentiviruses containing an shRNA-FXR construct targeting FXR.

    Techniques: Knockdown, shRNA, Control, Western Blot, Incubation, Staining, Comparison